Transcript: Mouse NM_001291016.1

Mus musculus BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Bcl2l11 (12125)
Length:
2304
CDS:
229..504

Additional Resources:

NCBI RefSeq record:
NM_001291016.1
NBCI Gene record:
Bcl2l11 (12125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231243 TGACAGAGAAGGTGGACAATT pLKO_005 264 CDS 100% 13.200 9.240 N Bcl2l11 n/a
2 TRCN0000009692 GTGACAGAGAAGGTGGACAAT pLKO.1 263 CDS 100% 4.950 3.465 N Bcl2l11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291016.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02292 pDONR223 100% 42.3% 38.3% None (many diffs) n/a
2 ccsbBroad304_02292 pLX_304 88.4% 42.3% 38.3% V5 (many diffs) n/a
3 TRCN0000469407 GTCTAGTATATTAGGCACTTGCCG pLX_317 65.9% 42.3% 38.3% V5 (many diffs) n/a
Download CSV