Transcript: Human NM_001291018.1

Homo sapiens phosphodiesterase 6D (PDE6D), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
PDE6D (5147)
Length:
1108
CDS:
214..495

Additional Resources:

NCBI RefSeq record:
NM_001291018.1
NBCI Gene record:
PDE6D (5147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296661 TTCCAGCTGACCAGACTAAAC pLKO_005 753 3UTR 100% 10.800 7.560 N PDE6D n/a
2 TRCN0000048849 GCACATCCAGAGTGAGACTTT pLKO.1 529 3UTR 100% 4.950 3.465 N PDE6D n/a
3 TRCN0000290577 GCACATCCAGAGTGAGACTTT pLKO_005 529 3UTR 100% 4.950 3.465 N PDE6D n/a
4 TRCN0000048851 ACAGGGAAGATACTCTGGCAA pLKO.1 292 CDS 100% 2.640 1.848 N PDE6D n/a
5 TRCN0000114885 GCTTCAAACTAAATTGGATGA pLKO.1 254 CDS 100% 4.050 2.430 N Pde6d n/a
6 TRCN0000332322 GCTTCAAACTAAATTGGATGA pLKO_005 254 CDS 100% 4.050 2.430 N Pde6d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01158 pDONR223 100% 62% 58.6% None 265_266ins106;279_280ins65 n/a
2 ccsbBroad304_01158 pLX_304 0% 62% 58.6% V5 265_266ins106;279_280ins65 n/a
3 TRCN0000468394 TGCAGCTTTACAACATGCACTCTG pLX_317 64.6% 62% 58.6% V5 265_266ins106;279_280ins65 n/a
Download CSV