Transcript: Mouse NM_001291068.1

Mus musculus polymerase (RNA) II (DNA directed) polypeptide A (Polr2a), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Polr2a (20020)
Length:
6736
CDS:
411..6323

Additional Resources:

NCBI RefSeq record:
NM_001291068.1
NBCI Gene record:
Polr2a (20020)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291068.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238348 ACTCACGGCAGTACGCAAATT pLKO_005 2033 CDS 100% 13.200 18.480 N Polr2a n/a
2 TRCN0000111463 GCTACACTTAAACCTTCTAAT pLKO.1 3129 CDS 100% 13.200 18.480 N Polr2a n/a
3 TRCN0000111464 CCGCTCATGAAATGCTCCTTT pLKO.1 4686 CDS 100% 4.950 6.930 N Polr2a n/a
4 TRCN0000238347 ACGGGTTCGAGGGAATCTAAT pLKO_005 1454 CDS 100% 13.200 10.560 N Polr2a n/a
5 TRCN0000238349 TACACCCACCAGCCCTAATTA pLKO_005 5738 CDS 100% 15.000 10.500 N Polr2a n/a
6 TRCN0000238346 AGTACATCATCCGCGATAATG pLKO_005 1660 CDS 100% 13.200 9.240 N Polr2a n/a
7 TRCN0000238345 TTGTATCTTCAACGATGATAA pLKO_005 4142 CDS 100% 13.200 9.240 N Polr2a n/a
8 TRCN0000111462 CGAGTGCATGAAATCTTCAAA pLKO.1 1068 CDS 100% 5.625 3.938 N Polr2a n/a
9 TRCN0000111460 GCCCTAACTATTCTCCAACTA pLKO.1 5644 CDS 100% 4.950 3.465 N Polr2a n/a
10 TRCN0000111461 GCTCATAACAATGAGCTAGAA pLKO.1 2568 CDS 100% 0.495 0.347 N Polr2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291068.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11044 pDONR223 100% 25.9% 28.3% None (many diffs) n/a
2 ccsbBroad304_11044 pLX_304 0% 25.9% 28.3% V5 (many diffs) n/a
3 TRCN0000475373 CCGCCCCATAATATCGCCTCATTT pLX_317 16.9% 25.9% 28.3% V5 (many diffs) n/a
Download CSV