Transcript: Mouse NM_001291184.1

Mus musculus proprotein convertase subtilisin/kexin type 6 (Pcsk6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-22
Taxon:
Mus musculus (mouse)
Gene:
Pcsk6 (18553)
Length:
4259
CDS:
36..2876

Additional Resources:

NCBI RefSeq record:
NM_001291184.1
NBCI Gene record:
Pcsk6 (18553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221982 GTGCTTGAACTGTGTCCACTT pLKO.1 2099 CDS 100% 4.050 3.240 N Pcsk6 n/a
2 TRCN0000334328 GTGCTTGAACTGTGTCCACTT pLKO_005 2099 CDS 100% 4.050 3.240 N Pcsk6 n/a
3 TRCN0000431667 GCTTTCGAGTATGGCATTAAA pLKO_005 978 CDS 100% 15.000 10.500 N PCSK6 n/a
4 TRCN0000221980 CCCAGCAGAGAAGAGTGTATT pLKO.1 2538 CDS 100% 13.200 9.240 N Pcsk6 n/a
5 TRCN0000334408 CCCAGCAGAGAAGAGTGTATT pLKO_005 2538 CDS 100% 13.200 9.240 N Pcsk6 n/a
6 TRCN0000221978 CCGGACTTTATGCTGATGAAA pLKO.1 2323 CDS 100% 5.625 3.938 N Pcsk6 n/a
7 TRCN0000334329 CCGGACTTTATGCTGATGAAA pLKO_005 2323 CDS 100% 5.625 3.938 N Pcsk6 n/a
8 TRCN0000221979 GCTGAAAGAATGGAGCCTCAT pLKO.1 1868 CDS 100% 4.050 2.835 N Pcsk6 n/a
9 TRCN0000334407 GCTGAAAGAATGGAGCCTCAT pLKO_005 1868 CDS 100% 4.050 2.835 N Pcsk6 n/a
10 TRCN0000221981 GTGTCGAAGATGTGAGGAGAA pLKO.1 2657 CDS 100% 4.050 2.835 N Pcsk6 n/a
11 TRCN0000334330 GTGTCGAAGATGTGAGGAGAA pLKO_005 2657 CDS 100% 4.050 2.835 N Pcsk6 n/a
12 TRCN0000437296 GCGAACGGAAGCTCTTCATTC pLKO_005 2821 CDS 100% 10.800 15.120 N PCSK6 n/a
13 TRCN0000075249 GCGTGGATGAACCTGAGAAAT pLKO.1 2386 CDS 100% 13.200 9.240 N PCSK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.