Transcript: Mouse NM_001291206.1

Mus musculus regulator of G-protein signaling 19 (Rgs19), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rgs19 (56470)
Length:
1863
CDS:
525..1175

Additional Resources:

NCBI RefSeq record:
NM_001291206.1
NBCI Gene record:
Rgs19 (56470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240367 CCACCTACCGCTCTCTATTAC pLKO_005 1123 CDS 100% 13.200 18.480 N LOC100047944 n/a
2 TRCN0000240370 AGAAGGCGCGACTTATCTATG pLKO_005 934 CDS 100% 10.800 15.120 N LOC100047944 n/a
3 TRCN0000240366 TGTGCGAGAAGGCATCAATAG pLKO_005 1004 CDS 100% 10.800 15.120 N LOC100047944 n/a
4 TRCN0000366648 ACGAGAAGGCGCGACTTATCT pLKO_005 931 CDS 100% 5.625 7.875 N Rgs19 n/a
5 TRCN0000037164 GCGACTTATCTATGAGGACTA pLKO.1 941 CDS 100% 4.050 5.670 N Rgs19 n/a
6 TRCN0000037165 CCGCAGTGTATTCCGGGCATT pLKO.1 824 CDS 100% 1.350 1.890 N Rgs19 n/a
7 TRCN0000366650 CTCAGAGTCAGACTCATATAA pLKO_005 1396 3UTR 100% 15.000 10.500 N Rgs19 n/a
8 TRCN0000366718 CCCACCTACCGCTCTCTATTA pLKO_005 1122 CDS 100% 13.200 9.240 N Rgs19 n/a
9 TRCN0000240369 GGCATTCCTGCGCACAGAATA pLKO_005 839 CDS 100% 13.200 9.240 N LOC100047944 n/a
10 TRCN0000037167 GTGTGCGAGAAGGCATCAATA pLKO.1 1003 CDS 100% 13.200 9.240 N Rgs19 n/a
11 TRCN0000377063 TGGCAACTGCAGGGTTCTAAG pLKO_005 1262 3UTR 100% 10.800 7.560 N Rgs19 n/a
12 TRCN0000377128 TTGGCAGGTTTCTCGGGAAAG pLKO_005 698 CDS 100% 6.000 4.200 N Rgs19 n/a
13 TRCN0000037166 CCATCGCCACACACATTTGAT pLKO.1 1038 CDS 100% 5.625 3.938 N Rgs19 n/a
14 TRCN0000377127 ACTCGTACCCTCGATTCCTTA pLKO_005 1096 CDS 100% 4.950 3.465 N Rgs19 n/a
15 TRCN0000037168 CCTCCCTCGATGTCCAGCCAT pLKO.1 582 CDS 100% 0.000 0.000 N Rgs19 n/a
16 TRCN0000376795 TGGCTTGTGAGGAGTTGAAAG pLKO_005 886 CDS 100% 10.800 6.480 N Rgs19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.