Transcript: Mouse NM_001291222.1

Mus musculus kinesin family member 7 (Kif7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Kif7 (16576)
Length:
4525
CDS:
29..4075

Additional Resources:

NCBI RefSeq record:
NM_001291222.1
NBCI Gene record:
Kif7 (16576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090439 CGAGTACAAGAATGAGGCTAT pLKO.1 3211 CDS 100% 4.050 3.240 N Kif7 n/a
2 TRCN0000090441 CGTGCTCAGAACATCCGCAAT pLKO.1 1061 CDS 100% 4.050 3.240 N Kif7 n/a
3 TRCN0000090438 GCCCAGAGTTCTGGAGATAAT pLKO.1 4365 3UTR 100% 13.200 9.240 N Kif7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13627 pDONR223 100% 52.1% 52.9% None (many diffs) n/a
2 ccsbBroad304_13627 pLX_304 0% 52.1% 52.9% V5 (many diffs) n/a
3 TRCN0000476193 GACCTCCTATACTGGGTTCTGTCC pLX_317 12.5% 52.1% 52.9% V5 (many diffs) n/a
Download CSV