Transcript: Mouse NM_001291483.1

Mus musculus midkine (Mdk), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mdk (17242)
Length:
915
CDS:
370..630

Additional Resources:

NCBI RefSeq record:
NM_001291483.1
NBCI Gene record:
Mdk (17242)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089103 CCCAAGATATAACCCACCAGT pLKO.1 695 3UTR 100% 2.640 1.848 N Mdk n/a
2 TRCN0000089106 CCTGCAACTGGAAGAAGGAAT pLKO.1 578 CDS 100% 4.950 2.970 N Mdk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00992 pDONR223 100% 51.9% 52.4% None (many diffs) n/a
2 ccsbBroad304_00992 pLX_304 0% 51.9% 52.4% V5 (many diffs) n/a
3 TRCN0000465551 CCTATCATCCAGACGTTTAAGGCG pLX_317 85.9% 51.9% 52.4% V5 (many diffs) n/a
Download CSV