Transcript: Human NM_001291485.2

Homo sapiens CEA cell adhesion molecule 7 (CEACAM7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CEACAM7 (1087)
Length:
2376
CDS:
106..903

Additional Resources:

NCBI RefSeq record:
NM_001291485.2
NBCI Gene record:
CEACAM7 (1087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119223 CATGCCAACTATCGAATTATA pLKO.1 325 CDS 100% 15.000 21.000 N CEACAM7 n/a
2 TRCN0000119225 GTCCTTCTAGTAGTCCATAAT pLKO.1 256 CDS 100% 13.200 9.240 N CEACAM7 n/a
3 TRCN0000119226 AGCGCCACAAAGAATGACATA pLKO.1 718 CDS 100% 4.950 3.465 N CEACAM7 n/a
4 TRCN0000119224 GCTATGAGTCAGTACAAGCAA pLKO.1 809 CDS 100% 3.000 2.100 N CEACAM7 n/a
5 TRCN0000119222 GCCTCTTTAATTTGGTAAGAT pLKO.1 1256 3UTR 100% 5.625 3.375 N CEACAM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05988 pDONR223 100% 99.8% 100% None 6G>T n/a
2 ccsbBroad304_05988 pLX_304 0% 99.8% 100% V5 6G>T n/a
3 TRCN0000470030 ACCACGAAGAGCGTGATTTAACCC pLX_317 62.7% 99.8% 100% V5 6G>T n/a
Download CSV