Transcript: Mouse NM_001291537.1

Mus musculus sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B (Sema3b), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sema3b (20347)
Length:
4010
CDS:
664..2913

Additional Resources:

NCBI RefSeq record:
NM_001291537.1
NBCI Gene record:
Sema3b (20347)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054801 CCAGATGACGTTATCCAGTTT pLKO.1 1846 CDS 100% 4.950 6.930 N Sema3b n/a
2 TRCN0000054800 CGGCTCTCCTTTCAAGAATTA pLKO.1 757 CDS 100% 13.200 10.560 N Sema3b n/a
3 TRCN0000054799 CGGAGGCAAGACATAAGGAAT pLKO.1 2320 CDS 100% 4.950 3.960 N Sema3b n/a
4 TRCN0000054798 CCCAAGTTTGTCAAGGTCTTT pLKO.1 1330 CDS 100% 4.950 3.465 N Sema3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01837 pDONR223 100% 83.3% 88.6% None (many diffs) n/a
2 ccsbBroad304_01837 pLX_304 0% 83.3% 88.6% V5 (many diffs) n/a
3 ccsbBroadEn_11245 pDONR223 100% 70.2% 75.4% None (many diffs) n/a
4 ccsbBroad304_11245 pLX_304 0% 70.2% 75.4% V5 (many diffs) n/a
Download CSV