Transcript: Human NM_001291737.1

Homo sapiens CD24 molecule (CD24), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
CD24 (100133941)
Length:
2440
CDS:
368..610

Additional Resources:

NCBI RefSeq record:
NM_001291737.1
NBCI Gene record:
CD24 (100133941)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057677 CGCAGATTTATTCCAGTGAAA pLKO.1 432 CDS 100% 4.950 6.930 N CD24 n/a
2 TRCN0000057674 TCCAACTAATGCCACCACCAA pLKO.1 514 CDS 100% 2.640 3.696 N CD24 n/a
3 TRCN0000245101 TGCTCCTACCCACGCAGATTT pLKO_005 420 CDS 100% 13.200 10.560 N CD24 n/a
4 TRCN0000306703 TGCTCCTACCCACGCAGATTT pLKO_005 420 CDS 100% 13.200 10.560 N Cd24a n/a
5 TRCN0000245105 ACTAATTTAATGCCGATATAC pLKO_005 1114 3UTR 100% 13.200 9.240 N CD24 n/a
6 TRCN0000245104 CTTCTGCATCTCTACTCTTAA pLKO_005 590 CDS 100% 13.200 9.240 N CD24 n/a
7 TRCN0000245102 ACAACTGGAACTTCAAGTAAC pLKO_005 455 CDS 100% 10.800 7.560 N CD24 n/a
8 TRCN0000245103 GCAGTCAACAGCCAGTCTCTT pLKO_005 553 CDS 100% 4.950 3.465 N CD24 n/a
9 TRCN0000057675 TCTTCTGCATCTCTACTCTTA pLKO.1 589 CDS 100% 4.950 3.465 N CD24 n/a
10 TRCN0000057673 CCCACGCAGATTTATTCCAGT pLKO.1 428 CDS 100% 2.640 1.848 N CD24 n/a
11 TRCN0000057676 GAGTACTTCCAACTCTGGGTT pLKO.1 484 CDS 100% 2.640 1.848 N CD24 n/a
12 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1626 3UTR 100% 4.950 2.475 Y n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1699 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1699 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05745 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05745 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466204 CTTAAACAGTACTTCGGATAGCAA pLX_317 100% 100% 100% V5 n/a
Download CSV