Transcript: Mouse NM_001291818.1

Mus musculus rhomboid 5 homolog 1 (Rhbdf1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rhbdf1 (13650)
Length:
2836
CDS:
670..2601

Additional Resources:

NCBI RefSeq record:
NM_001291818.1
NBCI Gene record:
Rhbdf1 (13650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032667 GCCAGCGGTATGGGAAGCTAA pLKO.1 478 5UTR 100% 1.650 2.310 N Rhbdf1 n/a
2 TRCN0000308462 GCCAGCGGTATGGGAAGCTAA pLKO_005 478 5UTR 100% 1.650 2.310 N Rhbdf1 n/a
3 TRCN0000374844 TTCTGGCTGTGTGCATCTATG pLKO_005 1289 CDS 100% 10.800 7.560 N Rhbdf1 n/a
4 TRCN0000032665 GCAGGCAACAAGAGACAGTTT pLKO.1 1645 CDS 100% 4.950 3.465 N Rhbdf1 n/a
5 TRCN0000032664 CTTCCTGGACACTGACCTCTT pLKO.1 2657 3UTR 100% 4.050 2.835 N Rhbdf1 n/a
6 TRCN0000308461 CTTCCTGGACACTGACCTCTT pLKO_005 2657 3UTR 100% 4.050 2.835 N Rhbdf1 n/a
7 TRCN0000032666 GCGCTGTGAATGGTGCGAGTT pLKO.1 2514 CDS 100% 1.350 0.945 N Rhbdf1 n/a
8 TRCN0000308545 GCGCTGTGAATGGTGCGAGTT pLKO_005 2514 CDS 100% 1.350 0.945 N Rhbdf1 n/a
9 TRCN0000048668 CTTTGGCAAGTTCGACCTGTA pLKO.1 2406 CDS 100% 4.050 2.430 N RHBDF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08850 pDONR223 100% 66% 71.8% None (many diffs) n/a
2 ccsbBroad304_08850 pLX_304 0% 66% 71.8% V5 (many diffs) n/a
3 TRCN0000477551 TGGGAGGTTGGTTGCGCTCGGTCT pLX_317 11.3% 66% 71.8% V5 (many diffs) n/a
Download CSV