Transcript: Mouse NM_001291835.1

Mus musculus aminolevulinic acid synthase 1 (Alas1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Alas1 (11655)
Length:
3089
CDS:
579..2507

Additional Resources:

NCBI RefSeq record:
NM_001291835.1
NBCI Gene record:
Alas1 (11655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295044 GAAAGAGAGAAAGCCTATTTC pLKO_005 2451 CDS 100% 13.200 9.240 N Alas1 n/a
2 TRCN0000076287 GAGTTGATGACCAGGCATAAT pLKO.1 2220 CDS 100% 13.200 9.240 N Alas1 n/a
3 TRCN0000287573 GAGTTGATGACCAGGCATAAT pLKO_005 2220 CDS 100% 13.200 9.240 N Alas1 n/a
4 TRCN0000295045 GTGTCGGTCTGGTGCAGTAAT pLKO_005 1317 CDS 100% 13.200 9.240 N Alas1 n/a
5 TRCN0000076283 CCAAGATAGTAGCATTTGAAA pLKO.1 1711 CDS 100% 5.625 3.938 N Alas1 n/a
6 TRCN0000298354 CCAAGATAGTAGCATTTGAAA pLKO_005 1711 CDS 100% 5.625 3.938 N Alas1 n/a
7 TRCN0000076285 CCCAAGATAGTAGCATTTGAA pLKO.1 1710 CDS 100% 5.625 3.938 N Alas1 n/a
8 TRCN0000045740 CCAGAAAGAGTGTCTCATCTT pLKO.1 1119 CDS 100% 4.950 3.465 N ALAS1 n/a
9 TRCN0000290785 CCAGAAAGAGTGTCTCATCTT pLKO_005 1119 CDS 100% 4.950 3.465 N ALAS1 n/a
10 TRCN0000076284 GCTGTGAAATTTACTCTGATT pLKO.1 1570 CDS 100% 4.950 3.465 N Alas1 n/a
11 TRCN0000076286 GATGAGTTGATGACCAGGCAT pLKO.1 2217 CDS 100% 2.640 1.848 N Alas1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05798 pDONR223 100% 87.1% 91.4% None (many diffs) n/a
2 ccsbBroad304_05798 pLX_304 0% 87.1% 91.4% V5 (many diffs) n/a
3 TRCN0000492066 AGGCCGAGACGGCTCGGATACTAA pLX_317 16.5% 87.1% 91.4% V5 (many diffs) n/a
Download CSV