Transcript: Human NM_001291949.2

Homo sapiens ADP-ribosylarginine hydrolase (ADPRH), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ADPRH (141)
Length:
3537
CDS:
397..1470

Additional Resources:

NCBI RefSeq record:
NM_001291949.2
NBCI Gene record:
ADPRH (141)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426889 GATTCCAGGAAATACCGATAT pLKO_005 1853 3UTR 100% 10.800 15.120 N ADPRH n/a
2 TRCN0000424316 GAAGGGAAGAGAGCTAGTATG pLKO_005 1896 3UTR 100% 10.800 7.560 N ADPRH n/a
3 TRCN0000433365 GTCCTTTAGCTCAATTGATAG pLKO_005 1672 3UTR 100% 10.800 7.560 N ADPRH n/a
4 TRCN0000049983 CCCTCCAACTATGAGAAACTA pLKO.1 1369 CDS 100% 5.625 3.938 N ADPRH n/a
5 TRCN0000049986 CATTGTCCAATCAGGCTACTT pLKO.1 1011 CDS 100% 4.950 3.465 N ADPRH n/a
6 TRCN0000049987 CCCTGAGTCTTTCGGTGTGAA pLKO.1 1131 CDS 100% 4.950 3.465 N ADPRH n/a
7 TRCN0000049984 CCTAAGTTGACTCAACTGTAT pLKO.1 616 CDS 100% 4.950 3.465 N ADPRH n/a
8 TRCN0000049985 CTTTATATTCTCTCGGGTCAA pLKO.1 1424 CDS 100% 4.050 2.835 N ADPRH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05784 pDONR223 100% 99.9% 100% None 546T>A n/a
2 ccsbBroad304_05784 pLX_304 0% 99.9% 100% V5 546T>A n/a
3 TRCN0000467215 GAGACTAACTGAGTCTGTATGGGC pLX_317 27.5% 99.9% 100% V5 546T>A n/a
Download CSV