Transcript: Human NM_001291984.2

Homo sapiens protein tyrosine phosphatase receptor type K (PTPRK), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
PTPRK (5796)
Length:
6003
CDS:
242..4561

Additional Resources:

NCBI RefSeq record:
NM_001291984.2
NBCI Gene record:
PTPRK (5796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427727 CTTAAGATCTCGGCGTATTAA pLKO_005 3589 CDS 100% 15.000 21.000 N PTPRK n/a
2 TRCN0000378570 GCCGGGTTAAATGCTATAAAT pLKO_005 3213 CDS 100% 15.000 21.000 N PTPRK n/a
3 TRCN0000002875 CCGGCGAGTCAAGTTATCAAA pLKO.1 3433 CDS 100% 5.625 7.875 N PTPRK n/a
4 TRCN0000356038 CCAATGAATATCAGGTAATAT pLKO_005 723 CDS 100% 15.000 10.500 N PTPRK n/a
5 TRCN0000378647 TAGATCCAGATACCGAATATG pLKO_005 1299 CDS 100% 13.200 9.240 N PTPRK n/a
6 TRCN0000420364 TGAACCATCTGCCACCTTATA pLKO_005 1602 CDS 100% 13.200 9.240 N PTPRK n/a
7 TRCN0000002876 CATACTTTCTACGTGGCATTT pLKO.1 4902 3UTR 100% 10.800 7.560 N PTPRK n/a
8 TRCN0000002874 GCCCAGACTAAGAACATCAAT pLKO.1 962 CDS 100% 5.625 3.938 N PTPRK n/a
9 TRCN0000002877 GCTCCAACTTTACCTGACTAT pLKO.1 2018 CDS 100% 4.950 3.465 N PTPRK n/a
10 TRCN0000002873 GCTGCTTTCATCGTCACACAA pLKO.1 3965 CDS 100% 4.950 3.465 N PTPRK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11077 pDONR223 100% 4.6% 2.7% None (many diffs) n/a
2 ccsbBroad304_11077 pLX_304 0% 4.6% 2.7% V5 (many diffs) n/a
3 TRCN0000465736 GATTACCTTCAGGCTCCGGTCCCC pLX_317 100% 4.6% 2.7% V5 (many diffs) n/a
Download CSV