Transcript: Human NM_001292025.1

Homo sapiens CUE domain containing 1 (CUEDC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CUEDC1 (404093)
Length:
3943
CDS:
720..1880

Additional Resources:

NCBI RefSeq record:
NM_001292025.1
NBCI Gene record:
CUEDC1 (404093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001292025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007700 GTCGGAAACGACTTTGGCTTT pLKO.1 1551 CDS 100% 4.050 5.670 N CUEDC1 n/a
2 TRCN0000007697 CCAGAGATGATCTGACCCGGT pLKO.1 1904 3UTR 100% 0.180 0.252 N CUEDC1 n/a
3 TRCN0000007699 GAACCTGATAGCTCGGATGAA pLKO.1 1074 CDS 100% 4.950 3.960 N CUEDC1 n/a
4 TRCN0000336980 ACGAATCCCAGAAATCTAAAT pLKO_005 1516 CDS 100% 13.200 9.240 N CUEDC1 n/a
5 TRCN0000350780 GAGATCTTGGAAAGGACTTTG pLKO_005 1053 CDS 100% 10.800 7.560 N CUEDC1 n/a
6 TRCN0000336981 GCAACCTTCCGGATGACTTTC pLKO_005 1255 CDS 100% 10.800 7.560 N CUEDC1 n/a
7 TRCN0000336982 TGGCTGTCGGAAACGACTTTG pLKO_005 1546 CDS 100% 10.800 7.560 N CUEDC1 n/a
8 TRCN0000007698 GCTGTGTCTGAAGATGCCTTA pLKO.1 1608 CDS 100% 4.050 2.835 N CUEDC1 n/a
9 TRCN0000337051 GCTGTGTCTGAAGATGCCTTA pLKO_005 1608 CDS 100% 4.050 2.835 N CUEDC1 n/a
10 TRCN0000007701 CATGGACGACTTCAAGACCAT pLKO.1 869 CDS 100% 2.640 1.848 N CUEDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001292025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10143 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10143 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475640 AACCTGAAGTGCTCCCGGAGCTAG pLX_317 16.4% 100% 100% V5 n/a
Download CSV