Transcript: Human NM_001292030.2

Homo sapiens tetratricopeptide repeat domain 39C (TTC39C), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
TTC39C (125488)
Length:
4133
CDS:
277..1107

Additional Resources:

NCBI RefSeq record:
NM_001292030.2
NBCI Gene record:
TTC39C (125488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001292030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148389 CCAGTGCTATTATGCCTACTT pLKO.1 513 CDS 100% 4.950 6.930 N TTC39C n/a
2 TRCN0000128943 CCCAGTTAAGCTGACATATTA pLKO.1 1234 3UTR 100% 15.000 10.500 N TTC39C n/a
3 TRCN0000422334 ATTTCTCTGGCTACGACTTTG pLKO_005 1022 CDS 100% 10.800 7.560 N TTC39C n/a
4 TRCN0000127768 GAGGAGGATGATGATGGTAAT pLKO.1 1301 3UTR 100% 10.800 7.560 N TTC39C n/a
5 TRCN0000130297 CGTCTATTGAAGTGTTGTACT pLKO.1 701 CDS 100% 4.950 3.465 N TTC39C n/a
6 TRCN0000147387 GATGAATTGTGTCGTCAGAAT pLKO.1 895 CDS 100% 4.950 3.465 N TTC39C n/a
7 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2931 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001292030.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04799 pDONR223 100% 51.9% 49.6% None (many diffs) n/a
2 ccsbBroad304_04799 pLX_304 0% 51.9% 49.6% V5 (many diffs) n/a
3 TRCN0000470153 TCACATTCGCGATCGCCTGCACAT pLX_317 28.3% 51.9% 49.6% V5 (many diffs) n/a
Download CSV