Transcript: Human NM_001292041.2

Homo sapiens hematopoietic cell-specific Lyn substrate 1 (HCLS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
HCLS1 (3059)
Length:
1881
CDS:
85..1434

Additional Resources:

NCBI RefSeq record:
NM_001292041.2
NBCI Gene record:
HCLS1 (3059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001292041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230930 CGTGGGCTGAAGGCGAAATTT pLKO_005 679 CDS 100% 15.000 21.000 N HCLS1 n/a
2 TRCN0000219050 GCAGTCGGCTTTGATTATAAA pLKO_005 487 CDS 100% 15.000 21.000 N HCLS1 n/a
3 TRCN0000230932 TTTGATCCGGACGACGTAATC pLKO_005 1318 CDS 100% 10.800 15.120 N HCLS1 n/a
4 TRCN0000014539 GACGACGTAATCACTGACATT pLKO.1 1327 CDS 100% 4.950 6.930 N HCLS1 n/a
5 TRCN0000014540 CGCCCATAGAAGCCGCTTCTA pLKO.1 650 CDS 100% 0.165 0.231 N HCLS1 n/a
6 TRCN0000014541 GAGGTCGGTTTGGAGTAGAAA pLKO.1 335 CDS 100% 5.625 3.938 N HCLS1 n/a
7 TRCN0000014542 CCTGCAAATTATGTCAAGCTT pLKO.1 1405 CDS 100% 3.000 2.100 N HCLS1 n/a
8 TRCN0000230933 TTCCCTCTCCTGCTTCATTAA pLKO_005 1547 3UTR 100% 13.200 7.920 N HCLS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001292041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06355 pDONR223 100% 92.1% 91.9% None (many diffs) n/a
2 ccsbBroad304_06355 pLX_304 0% 92.1% 91.9% V5 (many diffs) n/a
3 TRCN0000474708 CGATCAAGAACGGCAATCTTGAAC pLX_317 36.7% 92.1% 91.9% V5 (many diffs) n/a
Download CSV