Transcript: Human NM_001292054.1

Homo sapiens TBC1 domain family member 19 (TBC1D19), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
TBC1D19 (55296)
Length:
2922
CDS:
271..1656

Additional Resources:

NCBI RefSeq record:
NM_001292054.1
NBCI Gene record:
TBC1D19 (55296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001292054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432638 TAATCTTCGCAACCCAAATTA pLKO_005 564 CDS 100% 15.000 21.000 N TBC1D19 n/a
2 TRCN0000412883 CAACCACTTCGCATATCATTT pLKO_005 1390 CDS 100% 13.200 18.480 N TBC1D19 n/a
3 TRCN0000424173 ATATAGGACAACTGGGTATAG pLKO_005 695 CDS 100% 10.800 15.120 N TBC1D19 n/a
4 TRCN0000130737 GCTCAACAGTACATCAGACAA pLKO.1 805 CDS 100% 4.950 3.960 N TBC1D19 n/a
5 TRCN0000432365 GGTGGACAGTCTAATCTATAA pLKO_005 945 CDS 100% 13.200 9.240 N TBC1D19 n/a
6 TRCN0000130574 CGAGCTTTCTCTGGATACTTA pLKO.1 1423 CDS 100% 5.625 3.938 N TBC1D19 n/a
7 TRCN0000193212 CCTGAATTGAAAGAATGCTTT pLKO.1 658 CDS 100% 4.950 3.465 N Tbc1d19 n/a
8 TRCN0000130773 GCAGCTTAAGACCAATGTGAT pLKO.1 909 CDS 100% 4.950 3.465 N TBC1D19 n/a
9 TRCN0000174301 CCCTGAATTGAAAGAATGCTT pLKO.1 657 CDS 100% 3.000 2.100 N Tbc1d19 n/a
10 TRCN0000128876 GAACTATGCAAACTCTGCATA pLKO.1 1710 3UTR 100% 0.495 0.347 N TBC1D19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001292054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03575 pDONR223 100% 87.6% 87.6% None 98_99ins195 n/a
2 ccsbBroad304_03575 pLX_304 0% 87.6% 87.6% V5 98_99ins195 n/a
3 TRCN0000468467 CTCAGGGATCCCTAGTAACATTCT pLX_317 27.5% 87.6% 87.6% V5 98_99ins195 n/a
Download CSV