Transcript: Human NM_001293193.2

Homo sapiens odorant binding protein 2A (OBP2A), transcript variant delta, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
OBP2A (29991)
Length:
633
CDS:
56..499

Additional Resources:

NCBI RefSeq record:
NM_001293193.2
NBCI Gene record:
OBP2A (29991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059729 GAATCCTAATACCAACCTGGA pLKO.1 379 CDS 100% 2.160 3.024 N OBP2A n/a
2 TRCN0000059732 GATCGGTGCATCCAGAAGAAA pLKO.1 135 CDS 100% 5.625 3.375 N OBP2A n/a
3 TRCN0000059730 CCTGGCAAATTCAGCGCCTAT pLKO.1 180 CDS 100% 4.050 2.430 N OBP2A n/a
4 TRCN0000250150 GGAGGCCCTGGAAGAATTTAA pLKO_005 397 CDS 100% 15.000 7.500 Y OBP2B n/a
5 TRCN0000059728 CCCTGGAAGAATTTAAGAAAT pLKO.1 402 CDS 100% 13.200 6.600 Y OBP2A n/a
6 TRCN0000250153 GACTCTCGGAGGAGGACATTT pLKO_005 438 CDS 100% 13.200 6.600 Y OBP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03125 pDONR223 100% 65.3% 46.4% None 70_71ins134;254_318del n/a
2 ccsbBroad304_03125 pLX_304 0% 65.3% 46.4% V5 70_71ins134;254_318del n/a
3 TRCN0000476475 GCCCTAAGATTCAAAGCCGCAAAT pLX_317 60% 65.3% 46.4% V5 70_71ins134;254_318del n/a
Download CSV