Transcript: Human NM_001293632.2

Homo sapiens poly(A) polymerase alpha (PAPOLA), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
PAPOLA (10914)
Length:
4338
CDS:
798..2285

Additional Resources:

NCBI RefSeq record:
NM_001293632.2
NBCI Gene record:
PAPOLA (10914)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294190 TGAAGCCAGGAGTACTATTAT pLKO_005 2459 3UTR 100% 15.000 10.500 N PAPOLA n/a
2 TRCN0000053020 GCAGCATCTGTGACCAACATA pLKO.1 1740 CDS 100% 5.625 3.938 N PAPOLA n/a
3 TRCN0000298258 GCAGCATCTGTGACCAACATA pLKO_005 1740 CDS 100% 5.625 3.938 N PAPOLA n/a
4 TRCN0000053021 GCGTACTTACACAGAAACTAA pLKO.1 318 5UTR 100% 5.625 3.938 N PAPOLA n/a
5 TRCN0000286909 GCGTACTTACACAGAAACTAA pLKO_005 318 5UTR 100% 5.625 3.938 N PAPOLA n/a
6 TRCN0000175526 CTATTGAAACAGCCTGAAGAA pLKO.1 903 CDS 100% 4.950 3.465 N Papola n/a
7 TRCN0000279185 CTATTGAAACAGCCTGAAGAA pLKO_005 903 CDS 100% 4.950 3.465 N Papola n/a
8 TRCN0000053018 CCACGTACAATGTGTCCGTTT pLKO.1 1021 CDS 100% 4.050 2.835 N PAPOLA n/a
9 TRCN0000053019 GCTATCAAACTATGGGCCAAA pLKO.1 723 5UTR 100% 4.050 2.835 N PAPOLA n/a
10 TRCN0000294191 ACCATCTTATGCCTATAATTA pLKO_005 976 CDS 100% 15.000 9.000 N PAPOLA n/a
11 TRCN0000279187 TTGCAGGGTAACCGATGAAAT pLKO_005 656 5UTR 100% 13.200 7.920 N Papola n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08657 pDONR223 100% 44.5% 41.1% None (many diffs) n/a
2 ccsbBroad304_08657 pLX_304 0% 44.5% 41.1% V5 (many diffs) n/a
3 TRCN0000468084 CTTTTCATCAAGCTAGGAGATCAC pLX_317 24.9% 44.5% 41.1% V5 (many diffs) n/a
Download CSV