Transcript: Mouse NM_001293636.1

Mus musculus kinectin 1 (Ktn1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ktn1 (16709)
Length:
4407
CDS:
806..3952

Additional Resources:

NCBI RefSeq record:
NM_001293636.1
NBCI Gene record:
Ktn1 (16709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193732 CGAGTCTCAAAGGATGATTAA pLKO.1 3628 CDS 100% 13.200 18.480 N Ktn1 n/a
2 TRCN0000175872 GCAGAACTTATTAAGAGGCAA pLKO.1 2884 CDS 100% 2.640 3.696 N Ktn1 n/a
3 TRCN0000216417 GCCAAATTAAAGCCTTATTTA pLKO.1 3976 3UTR 100% 15.000 10.500 N Ktn1 n/a
4 TRCN0000217064 CTCATCCCTTCAGTAGTTATT pLKO.1 319 5UTR 100% 13.200 9.240 N Ktn1 n/a
5 TRCN0000215699 CAGAAGATCAAAGTGGTATAG pLKO.1 4213 3UTR 100% 10.800 7.560 N Ktn1 n/a
6 TRCN0000173131 CCCTCTCAGGAAGAATTACAA pLKO.1 3182 CDS 100% 5.625 3.938 N Ktn1 n/a
7 TRCN0000292833 CCCTCTCAGGAAGAATTACAA pLKO_005 3182 CDS 100% 5.625 3.938 N Ktn1 n/a
8 TRCN0000063519 CCCTTATTCATGCAACTACTT pLKO.1 969 CDS 100% 4.950 3.465 N KTN1 n/a
9 TRCN0000300981 CCCTTATTCATGCAACTACTT pLKO_005 969 CDS 100% 4.950 3.465 N KTN1 n/a
10 TRCN0000174716 GAAATAACTGATCTCTGCAAT pLKO.1 3227 CDS 100% 4.950 3.465 N Ktn1 n/a
11 TRCN0000292904 GAAATAACTGATCTCTGCAAT pLKO_005 3227 CDS 100% 4.950 3.465 N Ktn1 n/a
12 TRCN0000173586 GCAGAAACTTCCAGTAGTGTT pLKO.1 598 5UTR 100% 4.950 3.465 N Ktn1 n/a
13 TRCN0000173416 GCGAATGAACAGGATCACTTA pLKO.1 2159 CDS 100% 4.950 3.465 N Ktn1 n/a
14 TRCN0000292903 GCGAATGAACAGGATCACTTA pLKO_005 2159 CDS 100% 4.950 3.465 N Ktn1 n/a
15 TRCN0000175777 GCAAGAATGAAAGATCGGATT pLKO.1 1409 CDS 100% 4.050 2.835 N Ktn1 n/a
16 TRCN0000292832 GCAAGAATGAAAGATCGGATT pLKO_005 1409 CDS 100% 4.050 2.835 N Ktn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.