Transcript: Mouse NM_001293778.1

Mus musculus chromatin target of PRMT1 (Chtop), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Chtop (66511)
Length:
2300
CDS:
326..937

Additional Resources:

NCBI RefSeq record:
NM_001293778.1
NBCI Gene record:
Chtop (66511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140444 GATGGAGAATAGACCCTCTGT pLKO.1 499 CDS 100% 2.640 3.696 N CHTOP n/a
2 TRCN0000143524 GATGTCTCTAAATGAGCGCTT pLKO.1 373 CDS 100% 2.160 3.024 N CHTOP n/a
3 TRCN0000182440 GCGCCTGGGTAAGAGTAATAT pLKO.1 559 CDS 100% 15.000 12.000 N Chtop n/a
4 TRCN0000345317 GCGCCTGGGTAAGAGTAATAT pLKO_005 559 CDS 100% 15.000 12.000 N Chtop n/a
5 TRCN0000182232 CACCTGGATGCTGAATTGGAT pLKO.1 878 CDS 100% 3.000 2.400 N Chtop n/a
6 TRCN0000345249 CACCTGGATGCTGAATTGGAT pLKO_005 878 CDS 100% 3.000 2.400 N Chtop n/a
7 TRCN0000178554 CCTGTCATATACTCTTGACAT pLKO.1 1245 3UTR 100% 0.495 0.396 N Chtop n/a
8 TRCN0000345250 CCTGTCATATACTCTTGACAT pLKO_005 1245 3UTR 100% 0.495 0.396 N Chtop n/a
9 TRCN0000177690 CAACCAATTGGATGCATACAT pLKO.1 841 CDS 100% 5.625 3.938 N Chtop n/a
10 TRCN0000353184 CAACCAATTGGATGCATACAT pLKO_005 841 CDS 100% 5.625 3.938 N Chtop n/a
11 TRCN0000144541 CACCAAGATGTCTCTAAATGA pLKO.1 367 CDS 100% 5.625 3.938 N CHTOP n/a
12 TRCN0000198845 CAGACAGATCCTGAAACCAAT pLKO.1 911 CDS 100% 4.950 3.465 N Chtop n/a
13 TRCN0000140477 GCACCACCAAGATGTCTCTAA pLKO.1 363 CDS 100% 4.950 3.465 N CHTOP n/a
14 TRCN0000200390 GCTGAATTGGATGCCTACATG pLKO.1 887 CDS 100% 4.950 3.465 N Chtop n/a
15 TRCN0000139145 CAGCTGGACAACCAATTGGAT pLKO.1 833 CDS 100% 3.000 2.100 N CHTOP n/a
16 TRCN0000182748 CAGTGCCAGAAACAGAAGACT pLKO.1 469 CDS 100% 3.000 2.100 N Chtop n/a
17 TRCN0000182803 CTGGACAACCAATTGGATGCA pLKO.1 836 CDS 100% 2.640 1.848 N Chtop n/a
18 TRCN0000182779 CAGATGGAGAATAGACCCTCT pLKO.1 497 CDS 100% 2.160 1.512 N Chtop n/a
19 TRCN0000178578 CAGATCCTGAAACCAATGATT pLKO.1 915 CDS 100% 5.625 3.375 N Chtop n/a
20 TRCN0000200242 CCTGCCTGTTAGACTCTTGTT pLKO.1 956 3UTR 100% 4.950 2.970 N Chtop n/a
21 TRCN0000182262 GCTGGAGCTAAAGGTGTGTTT pLKO.1 1380 3UTR 100% 4.950 2.970 N Chtop n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11810 pDONR223 100% 78.5% 80.7% None (many diffs) n/a
2 ccsbBroad304_11810 pLX_304 0% 78.5% 80.7% V5 (many diffs) n/a
Download CSV