Transcript: Human NM_001297698.2

Homo sapiens Nanog homeobox (NANOG), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
NANOG (79923)
Length:
2049
CDS:
214..1083

Additional Resources:

NCBI RefSeq record:
NM_001297698.2
NBCI Gene record:
NANOG (79923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420864 GCATGCAGTTCCAGCCAAATT pLKO_005 917 CDS 100% 13.200 7.920 N NANOG n/a
2 TRCN0000004885 GCTTTGAAGCATCCGACTGTA pLKO.1 251 CDS 100% 4.950 2.970 N NANOG n/a
3 TRCN0000436615 AGATGAGTGAAACTGATATTA pLKO_005 1084 CDS 100% 15.000 7.500 Y NANOG n/a
4 TRCN0000429188 ACAGCAGACCACTAGGTATTT pLKO_005 996 CDS 100% 13.200 6.600 Y NANOG n/a
5 TRCN0000004887 CCTGGAACAGTCCCTTCTATA pLKO.1 869 CDS 100% 13.200 6.600 Y NANOG n/a
6 TRCN0000420670 GAGTATGGTTGGAGCCTAATC pLKO_005 1235 3UTR 100% 10.800 5.400 Y NANOG n/a
7 TRCN0000004888 CCTAAACTACTCCATGAACAT pLKO.1 1044 CDS 100% 4.950 2.475 Y NANOG n/a
8 TRCN0000004886 CTGTAAAGAATCTTCACCTAT pLKO.1 267 CDS 100% 4.950 2.475 Y NANOG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08987 pDONR223 100% 94.4% 94% None (many diffs) n/a
2 ccsbBroad304_08987 pLX_304 50.8% 94.4% 94% V5 (many diffs) n/a
3 TRCN0000474074 TCTCAATATACGGCGGTAAGTGCG pLX_317 44.6% 94.4% 94% V5 (many diffs) n/a
Download CSV