Transcript: Human NM_001300868.1

Homo sapiens solute carrier family 29 member 2 (SLC29A2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SLC29A2 (3177)
Length:
2730
CDS:
431..1801

Additional Resources:

NCBI RefSeq record:
NM_001300868.1
NBCI Gene record:
SLC29A2 (3177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043660 CGCTACTACCTGGCCAATAAA pLKO.1 1088 CDS 100% 15.000 21.000 N SLC29A2 n/a
2 TRCN0000043659 CCTCATGTCCATCGTGTGTTA pLKO.1 1039 CDS 100% 4.950 6.930 N SLC29A2 n/a
3 TRCN0000043662 CAGTCTGATGAGAACGGGATT pLKO.1 1157 CDS 100% 4.050 5.670 N SLC29A2 n/a
4 TRCN0000043658 GCTGCTCTTTGCCGTTTCTAA pLKO.1 1630 CDS 100% 5.625 3.938 N SLC29A2 n/a
5 TRCN0000043661 CCTTCCCTGGAACTTCTTCAT pLKO.1 508 CDS 100% 4.950 3.465 N SLC29A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488446 CTTCCCTGGACTCGCGATCGACTA pLX_317 20.3% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV