Transcript: Human NM_001300884.1

Homo sapiens cysteine rich hydrophobic domain 1 (CHIC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CHIC1 (53344)
Length:
6856
CDS:
138..752

Additional Resources:

NCBI RefSeq record:
NM_001300884.1
NBCI Gene record:
CHIC1 (53344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281545 CCGACTGGCTGACGTGTTAAT pLKO_005 4948 3UTR 100% 13.200 18.480 N CHIC1 n/a
2 TRCN0000262624 TGAATTTCCCTCCGTTCTAAC pLKO_005 461 CDS 100% 10.800 15.120 N CHIC1 n/a
3 TRCN0000262625 GCAGCCTATGGCCTGTTATTT pLKO_005 610 CDS 100% 15.000 10.500 N CHIC1 n/a
4 TRCN0000262626 GAGGAGCATCTGCGGAGATAT pLKO_005 369 CDS 100% 13.200 9.240 N CHIC1 n/a
5 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 307 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12019 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12019 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477704 AAATCCCATCCGTCAGCCTCCAGA pLX_317 66.9% 100% 100% V5 n/a
Download CSV