Transcript: Human NM_001300900.2

Homo sapiens mitochondrial ribosomal protein S34 (MRPS34), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MRPS34 (65993)
Length:
1019
CDS:
16..693

Additional Resources:

NCBI RefSeq record:
NM_001300900.2
NBCI Gene record:
MRPS34 (65993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146489 CATGATTATCGCAGAACGACA pLKO.1 552 CDS 100% 2.640 3.696 N MRPS34 n/a
2 TRCN0000275714 GAGATCGAACACGTCATGTAC pLKO_005 424 CDS 100% 4.950 3.960 N MRPS34 n/a
3 TRCN0000180550 GAATGTGCAGAGGATACGCAT pLKO.1 609 CDS 100% 2.640 2.112 N MRPS34 n/a
4 TRCN0000285424 GAATGTGCAGAGGATACGCAT pLKO_005 609 CDS 100% 2.640 2.112 N MRPS34 n/a
5 TRCN0000275713 TTCTGAGGGTCTGCATCTTAG pLKO_005 820 3UTR 100% 10.800 7.560 N MRPS34 n/a
6 TRCN0000275643 ACCCTGGGATTACCCTGCAAA pLKO_005 633 CDS 100% 4.950 3.465 N MRPS34 n/a
7 TRCN0000179621 GATTATCGCAGAACGACAGAA pLKO.1 555 CDS 100% 4.950 3.465 N MRPS34 n/a
8 TRCN0000180246 CCATGATTATCGCAGAACGAC pLKO.1 551 CDS 100% 2.640 1.848 N MRPS34 n/a
9 TRCN0000180375 GCCATGATTATCGCAGAACGA pLKO.1 550 CDS 100% 2.640 1.848 N MRPS34 n/a
10 TRCN0000275715 GCCATGATTATCGCAGAACGA pLKO_005 550 CDS 100% 2.640 1.848 N MRPS34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04005 pDONR223 100% 96.8% 96.8% None 363_383del n/a
2 TRCN0000466374 TAAGCGAGCACCTAGCTCAGCAGC pLX_317 63.3% 96.8% 96.8% V5 363_383del n/a
Download CSV