Transcript: Human NM_001301018.2

Homo sapiens actin binding LIM protein family member 3 (ABLIM3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
ABLIM3 (22885)
Length:
4296
CDS:
296..2248

Additional Resources:

NCBI RefSeq record:
NM_001301018.2
NBCI Gene record:
ABLIM3 (22885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008576 GCCCACGTCATCGAGATATTT pLKO.1 2386 3UTR 100% 15.000 21.000 N ABLIM3 n/a
2 TRCN0000415954 ACCGAGTCATCTGCGCTAAAG pLKO_005 1170 CDS 100% 10.800 15.120 N ABLIM3 n/a
3 TRCN0000429915 TCTACTGAAGCTCGGTATAAT pLKO_005 2302 3UTR 100% 15.000 10.500 N ABLIM3 n/a
4 TRCN0000008578 CCGGGCAGAGAAGAAGTTAAA pLKO.1 1090 CDS 100% 13.200 9.240 N ABLIM3 n/a
5 TRCN0000414224 TGTGGTTTCCACACCTTATTG pLKO_005 2626 3UTR 100% 13.200 9.240 N ABLIM3 n/a
6 TRCN0000008577 CGGCTGATTCTGAAGGAAGAA pLKO.1 1766 CDS 100% 4.950 3.465 N ABLIM3 n/a
7 TRCN0000008580 CCATCAAGATTCGTGGACCAA pLKO.1 720 CDS 100% 2.640 1.848 N ABLIM3 n/a
8 TRCN0000008579 GCTGGGAACATTATCTCCCTA pLKO.1 1342 CDS 100% 2.640 1.848 N ABLIM3 n/a
9 TRCN0000099547 GTGGATAATGAGATCCTTAAT pLKO.1 1190 CDS 100% 13.200 7.920 N Ablim3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11642 pDONR223 100% 83.3% 82.7% None (many diffs) n/a
2 ccsbBroad304_11642 pLX_304 0% 83.3% 82.7% V5 (many diffs) n/a
3 TRCN0000470912 TGAACTTAATCGTAGTCTGGCAAC pLX_317 16.5% 83.3% 82.7% V5 (many diffs) n/a
Download CSV