Transcript: Mouse NM_001301100.1

Mus musculus enhancer of mRNA decapping 4 (Edc4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Edc4 (234699)
Length:
4803
CDS:
197..4417

Additional Resources:

NCBI RefSeq record:
NM_001301100.1
NBCI Gene record:
Edc4 (234699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257176 ATCTGCGGGACATACTCAAAC pLKO_005 240 CDS 100% 10.800 15.120 N Edc4 n/a
2 TRCN0000243535 CAACGAACAAACCTGGTATAC pLKO_005 375 CDS 100% 10.800 15.120 N Edc4 n/a
3 TRCN0000257155 CAAGTTCTGGCAGATCTATAT pLKO_005 1159 CDS 100% 13.200 10.560 N Edc4 n/a
4 TRCN0000192932 GCCAAATCAAGCAAGGCTTTA pLKO.1 1047 CDS 100% 10.800 7.560 N Edc4 n/a
5 TRCN0000243537 TGCTCTACTGATTGTGGTAAC pLKO_005 4555 3UTR 100% 6.000 4.200 N Edc4 n/a
6 TRCN0000192127 CAGGAGTCAATCTTAGCACAA pLKO.1 3845 CDS 100% 4.050 2.835 N Edc4 n/a
7 TRCN0000201696 GCACTAATTTGGCAGCAGCAA pLKO.1 3065 CDS 100% 2.640 1.848 N Edc4 n/a
8 TRCN0000243536 AGACTGGCCAGCACTAATTTG pLKO_005 3055 CDS 100% 13.200 7.920 N Edc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.