Transcript: Mouse NM_001301295.1

Mus musculus cell death-inducing DFFA-like effector c (Cidec), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cidec (14311)
Length:
1720
CDS:
73..792

Additional Resources:

NCBI RefSeq record:
NM_001301295.1
NBCI Gene record:
Cidec (14311)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429372 GCTTAGAGGACTAACACTTAG pLKO_005 1018 3UTR 100% 10.800 15.120 N Cidec n/a
2 TRCN0000439503 CATCATACCTTGGCCTGAATC pLKO_005 1173 3UTR 100% 10.800 8.640 N Cidec n/a
3 TRCN0000191096 CAGGACATCTTGAAACTTAAA pLKO.1 283 CDS 100% 13.200 9.240 N Cidec n/a
4 TRCN0000201011 CCCTCCTGTAAGTAACCTAAA pLKO.1 1521 3UTR 100% 10.800 7.560 N Cidec n/a
5 TRCN0000200997 CAACCCTCTATGACACATACT pLKO.1 563 CDS 100% 4.950 3.465 N Cidec n/a
6 TRCN0000424516 CCCATCAGAACAGCGCAAGAA pLKO_005 426 CDS 100% 4.950 3.465 N Cidec n/a
7 TRCN0000412395 CTCATCATGCAGTAGACATTA pLKO_005 1139 3UTR 100% 13.200 7.920 N Cidec n/a
8 TRCN0000201957 CTATGACCTGCACTGCTACAA pLKO.1 591 CDS 100% 4.950 2.970 N Cidec n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.