Transcript: Mouse NM_001302261.1

Mus musculus peripheral myelin protein 22 (Pmp22), transcript variant 7, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pmp22 (18858)
Length:
1716
CDS:
296..574

Additional Resources:

NCBI RefSeq record:
NM_001302261.1
NBCI Gene record:
Pmp22 (18858)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302261.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087948 CCCGATACAAACGGTTCATAA pLKO.1 1357 3UTR 100% 13.200 18.480 N Pmp22 n/a
2 TRCN0000335500 CCCGATACAAACGGTTCATAA pLKO_005 1357 3UTR 100% 13.200 18.480 N Pmp22 n/a
3 TRCN0000348554 CATCACTGGATTCTTCCAAAT pLKO_005 382 CDS 100% 10.800 7.560 N Pmp22 n/a
4 TRCN0000348555 TCCTCAGTGGTATCATCTATG pLKO_005 531 CDS 100% 10.800 7.560 N Pmp22 n/a
5 TRCN0000087951 ACTCCTCATCAGTGAGCGAAT pLKO.1 252 5UTR 100% 4.050 2.835 N Pmp22 n/a
6 TRCN0000087950 CACTGACTACTCCTATGGCTT pLKO.1 472 CDS 100% 2.640 1.848 N Pmp22 n/a
7 TRCN0000087952 ACTGGATTCTTCCAAATCCTT pLKO.1 386 CDS 100% 0.300 0.210 N Pmp22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302261.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01229 pDONR223 100% 51.4% 52.5% None (many diffs) n/a
2 ccsbBroad304_01229 pLX_304 0% 51.4% 52.5% V5 (many diffs) n/a
3 TRCN0000473943 CCCATGCGTATATCACGGGGATAC pLX_317 70.6% 51.4% 52.5% V5 (many diffs) n/a
Download CSV