Transcript: Human NM_001302456.2

Homo sapiens endothelin 3 (EDN3), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
EDN3 (1908)
Length:
2406
CDS:
203..781

Additional Resources:

NCBI RefSeq record:
NM_001302456.2
NBCI Gene record:
EDN3 (1908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117876 CCTATGGACTGTCCAACTACA pLKO.1 579 CDS 100% 4.950 6.930 N EDN3 n/a
2 TRCN0000372055 CATAGCTCTACAGGAGTTTAT pLKO_005 1365 3UTR 100% 13.200 10.560 N EDN3 n/a
3 TRCN0000372111 TGCACGTGCTTCACCTACAAG pLKO_005 491 CDS 100% 4.950 3.960 N EDN3 n/a
4 TRCN0000117874 ACAAGGAGTGTGTCTACTATT pLKO.1 513 CDS 100% 13.200 9.240 N EDN3 n/a
5 TRCN0000117872 CCTTGATGTTTGTGACAAGAA pLKO.1 1488 3UTR 100% 4.950 3.465 N EDN3 n/a
6 TRCN0000117873 GTTGAAGTCAAGGACCAACAA pLKO.1 745 CDS 100% 4.950 3.465 N EDN3 n/a
7 TRCN0000372054 CATGTCCATCTTGTAATAAAT pLKO_005 1237 3UTR 100% 15.000 9.000 N EDN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00479 pDONR223 100% 80.6% 76.8% None 540_541ins46;576_577ins92 n/a
2 ccsbBroad304_00479 pLX_304 0% 80.6% 76.8% V5 540_541ins46;576_577ins92 n/a
3 TRCN0000467255 GGCCCACATTTACCTATTGACTTG pLX_317 67.8% 80.6% 76.8% V5 540_541ins46;576_577ins92 n/a
Download CSV