Transcript: Mouse NM_001302457.1

Mus musculus inhibitor of growth family, member 1 (Ing1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ing1 (26356)
Length:
1877
CDS:
180..737

Additional Resources:

NCBI RefSeq record:
NM_001302457.1
NBCI Gene record:
Ing1 (26356)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088078 GCCGCAATTTAGAAACTACAA pLKO.1 924 3UTR 100% 4.950 6.930 N Ing1 n/a
2 TRCN0000309291 GCCGCAATTTAGAAACTACAA pLKO_005 924 3UTR 100% 4.950 6.930 N Ing1 n/a
3 TRCN0000088081 GCTGGACGACTACTATGAGAA pLKO.1 47 5UTR 100% 4.950 6.930 N Ing1 n/a
4 TRCN0000309292 GCTGGACGACTACTATGAGAA pLKO_005 47 5UTR 100% 4.950 6.930 N Ing1 n/a
5 TRCN0000305369 TCGGCTGTGACAACGACGAAT pLKO_005 568 CDS 100% 4.950 6.930 N Ing1 n/a
6 TRCN0000088079 GCGTCGAATAATCACGACCAT pLKO.1 381 CDS 100% 2.640 3.696 N Ing1 n/a
7 TRCN0000305368 ACAGGCAGATAAGCCGAATAA pLKO_005 317 CDS 100% 13.200 9.240 N Ing1 n/a
8 TRCN0000311282 GGCAGCGAAACAATGAGAATC pLKO_005 352 CDS 100% 10.800 7.560 N Ing1 n/a
9 TRCN0000232655 CCATCGAGTGGTTCCACTTCT pLKO_005 592 CDS 100% 4.950 2.475 Y ING1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00869 pDONR223 100% 56% 59.4% None (many diffs) n/a
2 ccsbBroad304_00869 pLX_304 2.9% 56% 59.4% V5 (many diffs) n/a
3 TRCN0000476009 GTATCTAACTCTTTTTTGAATTCG pLX_317 38.6% 56% 59.4% V5 (many diffs) n/a
Download CSV