Construct: ORF TRCN0000476009
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004989.1_s317c1
- Derived from:
- ccsbBroadEn_00869
- DNA Barcode:
- GTATCTAACTCTTTTTTGAATTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ING1 (3621)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476009
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3621 | ING1 | inhibitor of growth family ... | NM_198219.3 | 100% | 100% | |
| 2 | human | 3621 | ING1 | inhibitor of growth family ... | NM_001267728.1 | 89.3% | 84.8% | (many diffs) |
| 3 | human | 3621 | ING1 | inhibitor of growth family ... | NM_198217.2 | 84.1% | 83.8% | 0_1ins128;3_3delGinsACCAA |
| 4 | human | 3621 | ING1 | inhibitor of growth family ... | NM_198218.2 | 75.2% | 75.2% | 0_1ins207 |
| 5 | human | 3621 | ING1 | inhibitor of growth family ... | NM_005537.5 | 63.3% | 57.4% | (many diffs) |
| 6 | human | 27160 | INGX | inhibitor of growth family,... | NR_002226.3 | 25.6% | (many diffs) | |
| 7 | mouse | 26356 | Ing1 | inhibitor of growth family,... | NM_011919.5 | 85.4% | 90.3% | (many diffs) |
| 8 | mouse | 26356 | Ing1 | inhibitor of growth family,... | NM_001302451.1 | 73.5% | 77.7% | (many diffs) |
| 9 | mouse | 26356 | Ing1 | inhibitor of growth family,... | NM_001302457.1 | 56% | 59.4% | (many diffs) |
| 10 | mouse | 26356 | Ing1 | inhibitor of growth family,... | NM_001302458.1 | 56% | 59.4% | (many diffs) |
| 11 | mouse | 26356 | Ing1 | inhibitor of growth family,... | NM_001302459.1 | 56% | 59.4% | (many diffs) |
| 12 | mouse | 26356 | Ing1 | inhibitor of growth family,... | NM_001302460.1 | 56% | 59.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 906
- ORF length:
- 837
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gttgagtcct gccaacgggg agcagctcca cctggtgaac tatgtggagg 121 actacctgga ctccatcgag tccctgcctt tcgacttgca gagaaatgtc tcgctgatgc 181 gggagatcga cgcgaaatac caagagatcc tgaaggagct agacgagtgc tacgagcgct 241 tcagtcgcga gacagacggg gcgcagaagc ggcggatgct gcactgtgtg cagcgcgcgc 301 tgatccgcag ccaggagctg ggcgacgaga agatccagat cgtgagccag atggtggagc 361 tggtggagaa ccgcacgcgg caggtggaca gccacgtgga gctgttcgag gcgcagcagg 421 agctgggcga cacagcgggc aacagcggca aggctggcgc ggacaggccc aaaggcgagg 481 cggcagcgca ggctgacaag cccaacagca agcgctcacg gcggcagcgc aacaacgaga 541 accgtgagaa cgcgtccagc aaccacgacc acgacgacgg cgccTCGGGC ACACCCAAGG 601 AGAAGAAGGC CAAGACCTCC AAGAAGAAGA AGCGCTCCAA GGCCAAGGCG GAGCGAGAGG 661 CGTCCCCTGC CGACCTCCCC ATCGACCCCA ACGAACCCAC GTACTGTCTG TGCAACCAGG 721 TCTCCTATGG GGAGATGATC GGCTGCGACA ACGACGAGTG CCCCATCGAG TGGTTCCACT 781 TCTCGTGCGT GGGGCTCAAT CATAAACCCA AGGGCAAGTG GTACTGTCCC AAGTGCCGGG 841 GGGAGAACGA GAAGACCATG GACAAAGCCC TGGAGAAATC CAAAAAAGAG AGGGCTTACA 901 ACAGGTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGTATCTAAC TCTTTTTTGA ATTCGACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt