Transcript: Human NM_001303062.2

Homo sapiens transmembrane p24 trafficking protein 4 (TMED4), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TMED4 (222068)
Length:
2517
CDS:
426..932

Additional Resources:

NCBI RefSeq record:
NM_001303062.2
NBCI Gene record:
TMED4 (222068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303062.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072834 GCGCTGTTTCATCGAGGAAAT pLKO.1 142 5UTR 100% 10.800 15.120 N TMED4 n/a
2 TRCN0000072837 GAGCAGGATTACCAAAGGTAT pLKO.1 765 CDS 100% 4.950 6.930 N TMED4 n/a
3 TRCN0000072833 CCCTGGTTCTTAAGGACACAT pLKO.1 1087 3UTR 100% 4.950 3.465 N TMED4 n/a
4 TRCN0000072835 GCCAACAACTACCCTGAGATT pLKO.1 669 CDS 100% 4.950 3.465 N TMED4 n/a
5 TRCN0000072836 TGCCAACAACTACCCTGAGAT pLKO.1 668 CDS 100% 4.950 3.465 N TMED4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303062.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05268 pDONR223 100% 73.8% 74% None 0_1ins177;213G>T n/a
2 ccsbBroad304_05268 pLX_304 0% 73.8% 74% V5 0_1ins177;213G>T n/a
3 TRCN0000491679 ACAGCACTAGCAGGAACCTGGACT pLX_317 46% 73.8% 74% V5 0_1ins177;213G>T n/a
Download CSV