Transcript: Human NM_001303124.2

Homo sapiens zinc finger CCCH-type containing 10 (ZC3H10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZC3H10 (84872)
Length:
7261
CDS:
310..1614

Additional Resources:

NCBI RefSeq record:
NM_001303124.2
NBCI Gene record:
ZC3H10 (84872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159260 GACGTCATGATCTCTATGATA pLKO.1 863 CDS 100% 5.625 7.875 N ZC3H10 n/a
2 TRCN0000162894 GAAGCGGGTAGAGGAGTTAAA pLKO.1 1053 CDS 100% 13.200 9.240 N ZC3H10 n/a
3 TRCN0000241949 GAGGATGAGGATGGCTATAAG pLKO_005 607 CDS 100% 13.200 9.240 N Zc3h10 n/a
4 TRCN0000422131 GCAATCAGGCCAAGGTCATAA pLKO_005 1136 CDS 100% 13.200 9.240 N ZC3H10 n/a
5 TRCN0000162653 CGACGTCATGATCTCTATGAT pLKO.1 862 CDS 100% 5.625 3.938 N ZC3H10 n/a
6 TRCN0000437178 GTCCCTATCTGCCGTGACTTT pLKO_005 718 CDS 100% 4.950 3.465 N ZC3H10 n/a
7 TRCN0000414070 CAAGAGACTACAAGGAGTATG pLKO_005 1729 3UTR 100% 10.800 6.480 N ZC3H10 n/a
8 TRCN0000161822 CAGACAATTTGGGTCCTAGTT pLKO.1 2055 3UTR 100% 4.950 2.970 N ZC3H10 n/a
9 TRCN0000162156 CTTCAGACAATTTGGGTCCTA pLKO.1 2052 3UTR 100% 2.640 1.584 N ZC3H10 n/a
10 TRCN0000162920 GAATCACAATGAGCCACACCA pLKO.1 1529 CDS 100% 2.640 1.584 N ZC3H10 n/a
11 TRCN0000257093 GAGGAGCCAAGTGCAAGTTTC pLKO_005 758 CDS 100% 10.800 7.560 N Zc3h10 n/a
12 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 5793 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3418 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3418 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09232 pDONR223 100% 99.9% 99.7% None 4C>N n/a
2 ccsbBroad304_09232 pLX_304 0% 99.9% 99.7% V5 4C>N n/a
3 TRCN0000480901 TTTTGTTATTCTTCTGCTATGGAG pLX_317 23.7% 99.9% 99.7% V5 4C>N n/a
Download CSV