Transcript: Mouse NM_001303271.1

Mus musculus ArfGAP with FG repeats 2 (Agfg2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Agfg2 (231801)
Length:
2950
CDS:
175..1644

Additional Resources:

NCBI RefSeq record:
NM_001303271.1
NBCI Gene record:
Agfg2 (231801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001303271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110833 GTTCCTCCAATCTCGTGGAAA pLKO.1 465 CDS 100% 4.950 6.930 N Agfg2 n/a
2 TRCN0000110831 CGGACATCGTTGATACCAGAT pLKO.1 526 CDS 100% 4.050 5.670 N Agfg2 n/a
3 TRCN0000325397 CGGACATCGTTGATACCAGAT pLKO_005 526 CDS 100% 4.050 5.670 N Agfg2 n/a
4 TRCN0000110830 GCTCGAATGTAGGGTAAAGAT pLKO.1 2107 3UTR 100% 5.625 3.938 N Agfg2 n/a
5 TRCN0000325458 GCTCGAATGTAGGGTAAAGAT pLKO_005 2107 3UTR 100% 5.625 3.938 N Agfg2 n/a
6 TRCN0000147372 GTCAATCTCCATGACAACTTT pLKO.1 426 CDS 100% 5.625 3.938 N AGFG2 n/a
7 TRCN0000110832 CCTTCTACCAACCCATTCCAA pLKO.1 1336 CDS 100% 3.000 2.100 N Agfg2 n/a
8 TRCN0000353974 CCTTCTACCAACCCATTCCAA pLKO_005 1336 CDS 100% 3.000 2.100 N Agfg2 n/a
9 TRCN0000110834 CTGGGATCTCTACCAATCCTT pLKO.1 1565 CDS 100% 3.000 2.100 N Agfg2 n/a
10 TRCN0000354050 CTGGGATCTCTACCAATCCTT pLKO_005 1565 CDS 100% 3.000 2.100 N Agfg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13875 pDONR223 100% 27.8% 28.4% None (many diffs) n/a
2 ccsbBroad304_13875 pLX_304 0% 27.8% 28.4% V5 (many diffs) n/a
3 TRCN0000479605 CACTTCATTTGTATTATAGTATAT pLX_317 82.6% 27.8% 28.4% V5 (many diffs) n/a
Download CSV