Transcript: Human NM_001303277.3

Homo sapiens integrin subunit beta 1 binding protein 2 (ITGB1BP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ITGB1BP2 (26548)
Length:
1027
CDS:
174..848

Additional Resources:

NCBI RefSeq record:
NM_001303277.3
NBCI Gene record:
ITGB1BP2 (26548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303277.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413582 GATGCCATCTCGGGTTGAAAT pLKO_005 653 CDS 100% 13.200 18.480 N ITGB1BP2 n/a
2 TRCN0000146384 CCAGACAGTTGATGTCTAGAT pLKO.1 854 3UTR 100% 0.495 0.693 N ITGB1BP2 n/a
3 TRCN0000195744 CCCAGGATGTGATGCTGTTTA pLKO.1 257 CDS 100% 13.200 9.240 N Itgb1bp2 n/a
4 TRCN0000414782 AGATTCCACTTCCTGCGTTTA pLKO_005 511 CDS 100% 10.800 7.560 N ITGB1BP2 n/a
5 TRCN0000438361 TCTGAAGCTGCTGCCGCTAAA pLKO_005 134 5UTR 100% 10.800 7.560 N ITGB1BP2 n/a
6 TRCN0000147532 GAAGAATCTGACGATTCAGAT pLKO.1 774 CDS 100% 0.495 0.347 N ITGB1BP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303277.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11831 pDONR223 100% 68% 68% None 0_1ins315 n/a
2 ccsbBroad304_11831 pLX_304 0% 68% 68% V5 0_1ins315 n/a
3 TRCN0000475403 TGATAGCGCTCTGCCTGGGTCAAC pLX_317 17.1% 68% 68% V5 0_1ins315 n/a
Download CSV