Transcript: Human NM_001303402.2

Homo sapiens WD repeat domain 48 (WDR48), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
WDR48 (57599)
Length:
3886
CDS:
178..1965

Additional Resources:

NCBI RefSeq record:
NM_001303402.2
NBCI Gene record:
WDR48 (57599)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151626 GTGCAGGTTTCCTATGTTATT pLKO.1 53 5UTR 100% 13.200 10.560 N WDR48 n/a
2 TRCN0000150552 GCAGAGATGTATAGCAACATA pLKO.1 654 CDS 100% 5.625 3.938 N WDR48 n/a
3 TRCN0000151698 CCTCAAATAACACTGTCACAA pLKO.1 392 CDS 100% 4.950 3.465 N WDR48 n/a
4 TRCN0000151552 GCAGACTATGTCTTTCAAGAT pLKO.1 2200 3UTR 100% 4.950 3.465 N WDR48 n/a
5 TRCN0000154887 CCTTTCTACCTCCAACCTCAT pLKO.1 1627 CDS 100% 4.050 2.835 N WDR48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12373 pDONR223 100% 84.3% 84.3% None 1_279del n/a
2 ccsbBroad304_12373 pLX_304 0% 84.3% 84.3% V5 1_279del n/a
3 TRCN0000477456 CATGAATGCACAGCCTCTCATTGC pLX_317 21.1% 84.3% 84.3% V5 1_279del n/a
Download CSV