Transcript: Human NM_001303406.2

Homo sapiens CWF19 like cell cycle control factor 1 (CWF19L1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CWF19L1 (55280)
Length:
2325
CDS:
191..1396

Additional Resources:

NCBI RefSeq record:
NM_001303406.2
NBCI Gene record:
CWF19L1 (55280)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075120 CCCAGTTTAAGGGTGTTGATA pLKO.1 210 CDS 100% 5.625 7.875 N CWF19L1 n/a
2 TRCN0000075119 GCTCTACTACTGATGACATTA pLKO.1 1056 CDS 100% 13.200 9.240 N CWF19L1 n/a
3 TRCN0000432046 CATATCGAAACCATATCATTC pLKO_005 396 CDS 100% 10.800 7.560 N CWF19L1 n/a
4 TRCN0000075122 CGAGGGAAATGGTGTGTTGTA pLKO.1 974 CDS 100% 4.950 3.465 N CWF19L1 n/a
5 TRCN0000075121 GCTTGAAACCAAGATACCATT pLKO.1 339 CDS 100% 4.950 3.465 N CWF19L1 n/a
6 TRCN0000075118 CCACAGGAAGTAGTAAAGCTT pLKO.1 1424 3UTR 100% 3.000 2.100 N CWF19L1 n/a
7 TRCN0000166498 CGCCTGTAATCCCAGTACTTT pLKO.1 1930 3UTR 100% 5.625 2.813 Y MGC13053 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08504 pDONR223 100% 74.5% 74.5% None 0_1ins411 n/a
2 ccsbBroad304_08504 pLX_304 0% 74.5% 74.5% V5 0_1ins411 n/a
3 TRCN0000465749 TCGGTGCGACCACCAACACATAGC pLX_317 23.3% 74.5% 74.5% V5 0_1ins411 n/a
Download CSV