Transcript: Human NM_001303462.1

Homo sapiens ovo like zinc finger 2 (OVOL2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
OVOL2 (58495)
Length:
1107
CDS:
185..616

Additional Resources:

NCBI RefSeq record:
NM_001303462.1
NBCI Gene record:
OVOL2 (58495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303462.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017788 CAGGCATTCGTCCCTACAAAT pLKO.1 297 CDS 100% 13.200 18.480 N OVOL2 n/a
2 TRCN0000417893 ACGTTCACACTGCCACGTATG pLKO_005 638 3UTR 100% 6.000 8.400 N OVOL2 n/a
3 TRCN0000017789 CAAATGCAACGTCTGCAATAA pLKO.1 313 CDS 100% 13.200 9.240 N OVOL2 n/a
4 TRCN0000417988 AGTTGCTCACATTCACCAAAG pLKO_005 828 3UTR 100% 6.000 4.200 N OVOL2 n/a
5 TRCN0000413085 CATCAGCAGTAGGGTCCATTC pLKO_005 748 3UTR 100% 6.000 4.200 N OVOL2 n/a
6 TRCN0000424070 ACATCCGCACACCAGGAGAAT pLKO_005 563 CDS 100% 4.950 3.465 N OVOL2 n/a
7 TRCN0000017792 GCAGCAGTATGCCTATAAGCA pLKO.1 391 CDS 100% 3.000 2.100 N OVOL2 n/a
8 TRCN0000017790 CCGTCACCTCAAGTGCCACAA pLKO.1 193 CDS 100% 1.350 0.945 N OVOL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303462.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03864 pDONR223 100% 52% 52% None 0_1ins396 n/a
2 ccsbBroad304_03864 pLX_304 0% 52% 52% V5 0_1ins396 n/a
3 TRCN0000472531 GCAAGGTGGTGTTTACCTGCATCA pLX_317 45.6% 52% 52% V5 0_1ins396 n/a
Download CSV