Construct: ORF TRCN0000472531
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017897.1_s317c1
- Derived from:
- ccsbBroadEn_03864
- DNA Barcode:
- GCAAGGTGGTGTTTACCTGCATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OVOL2 (58495)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472531
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 58495 | OVOL2 | ovo like zinc finger 2 | NM_021220.4 | 100% | 100% | |
| 2 | human | 58495 | OVOL2 | ovo like zinc finger 2 | NM_001303461.1 | 52% | 52% | 0_1ins396 |
| 3 | human | 58495 | OVOL2 | ovo like zinc finger 2 | NM_001303462.1 | 52% | 52% | 0_1ins396 |
| 4 | mouse | 107586 | Ovol2 | ovo like zinc finger 2 | NM_026924.3 | 85.8% | 89% | (many diffs) |
| 5 | mouse | 107586 | Ovol2 | ovo like zinc finger 2 | NM_152947.2 | 74.5% | 77.4% | (many diffs) |
| 6 | mouse | 107586 | Ovol2 | ovo like zinc finger 2 | XM_006498544.3 | 44.9% | 48.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 891
- ORF length:
- 825
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttgacatgcc caaagtcttc ctggtgaaga ggaggagcct gggggtctcg gtccgcagct 121 gggatgagct cccggatgag aaaagggcag acacctacat cccagtgggc ctaggccgcc 181 tgctccacga cccccccgag gactgccgca gcgacggcgg cagcagcagc ggcagcggca 241 gcagcagcgc gggggagcct ggaggagcag agagcagctc gtccccgcac gcccccgaga 301 gcgaaacccc cgagcccggc gacgccgagg gccccgatgg acacctggcg accaagcagc 361 gcccggtcgc cagatcgaaa atcaagttca ccacaggcac gtgcagcgac tcggtggttc 421 acagctgtga cctgtgtggc aagggcttcc gtctgcagcg catgctgaac cgtcacctca 481 agtgccacaa ccaggtgaaa agacacctgt gcaccTTCTG CGGCAAGGGC TTCAACGACA 541 CCTTCGACCT GAAGAGGCAC GTCCGCACAC ACACAGGCAT TCGTCCCTAC AAATGCAACG 601 TCTGCAATAA AGCCTTCACC CAGCGCTGCT CTCTGGAGTC CCACCTGAAG AAAATCCATG 661 GGGTGCAGCA GCAGTATGCC TATAAGCAGC GGCGGGACAA GCTCTACGTC TGCGAGGATT 721 GCGGCTACAC GGGCCCCACC CAGGAGGACC TGTACCTGCA CGTGAACAGT GCCCATCCGG 781 GCAGCTCGTT TCTCAAAAAG ACATCTAAAA AACTGGCAGC CCTTCTGCAG GGCAAGCTGA 841 CATCCGCACA CCAGGAGAAT ACCAGCCTGA GTGAGGAGGA GGAGAGGAAG TGCTCAACTT 901 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 961 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1021 CTTGTGGAAA GGACGAGCAA GGTGGTGTTT ACCTGCATCA ACGCGTTAAG TCgacaatca 1081 acctctggat tacaaaattt gtgaaagatt