Transcript: Human NM_001303494.2

Homo sapiens chromobox 6 (CBX6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CBX6 (23466)
Length:
5998
CDS:
27..1211

Additional Resources:

NCBI RefSeq record:
NM_001303494.2
NBCI Gene record:
CBX6 (23466)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019067 CCGCGTTATAGGCAAGAGCAA pLKO.1 590 CDS 100% 2.640 3.696 N CBX6 n/a
2 TRCN0000343463 CCGCGTTATAGGCAAGAGCAA pLKO_005 590 CDS 100% 2.640 3.696 N CBX6 n/a
3 TRCN0000019068 GCGTACACAGATCCGCCACAT pLKO.1 632 CDS 100% 1.350 1.890 N CBX6 n/a
4 TRCN0000352855 GCGTACACAGATCCGCCACAT pLKO_005 632 CDS 100% 1.350 1.890 N CBX6 n/a
5 TRCN0000019065 GCATCGAGTACCTGGTGAAAT pLKO.1 100 CDS 100% 13.200 9.240 N CBX6 n/a
6 TRCN0000343456 GCATCGAGTACCTGGTGAAAT pLKO_005 100 CDS 100% 13.200 9.240 N CBX6 n/a
7 TRCN0000019066 TGACGGTCACAATCAAGGAAT pLKO.1 1105 CDS 100% 4.950 3.465 N CBX6 n/a
8 TRCN0000343413 TGACGGTCACAATCAAGGAAT pLKO_005 1105 CDS 100% 4.950 3.465 N CBX6 n/a
9 TRCN0000176234 GAGTACCTGGTGAAATGGAAA pLKO.1 105 CDS 100% 4.950 2.970 N Cbx6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15761 pDONR223 0% 95.6% 95.6% None 243_244ins54 n/a
2 ccsbBroad304_15761 pLX_304 0% 95.6% 95.6% V5 243_244ins54 n/a
3 ccsbBroadEn_07888 pDONR223 100% 95.5% 95.3% None 243_244ins54;821C>T n/a
4 ccsbBroad304_07888 pLX_304 0% 95.5% 95.3% V5 243_244ins54;821C>T n/a
5 TRCN0000465786 TGTCTCCGTTCACACTTGATGTGA pLX_317 23.3% 95.5% 95.3% V5 243_244ins54;821C>T n/a
Download CSV