Transcript: Human NM_001304347.2

Homo sapiens olfactomedin 2 (OLFM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
OLFM2 (93145)
Length:
2089
CDS:
185..1621

Additional Resources:

NCBI RefSeq record:
NM_001304347.2
NBCI Gene record:
OLFM2 (93145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378937 CAAGGTCTACTTCGCCTATTT pLKO_005 1426 CDS 100% 13.200 18.480 N OLFM2 n/a
2 TRCN0000204323 CGGCTCCCTGTTCTATAACAA pLKO.1 1081 CDS 100% 5.625 7.875 N OLFM2 n/a
3 TRCN0000188235 CGTGGTGGTCAAATACCACTT pLKO.1 1114 CDS 100% 0.405 0.567 N OLFM2 n/a
4 TRCN0000185633 GCCTATGTATTTCTGTCTATT pLKO.1 1764 3UTR 100% 13.200 9.240 N OLFM2 n/a
5 TRCN0000373121 TCATCAAAGGCCAGAACTTTA pLKO_005 1008 CDS 100% 13.200 9.240 N OLFM2 n/a
6 TRCN0000189139 GCTCTGGTTCTCCAGTTCTTT pLKO.1 1879 3UTR 100% 5.625 3.938 N OLFM2 n/a
7 TRCN0000187247 CTTCATCAAAGGCCAGAACTT pLKO.1 1006 CDS 100% 4.950 3.465 N OLFM2 n/a
8 TRCN0000188542 CCACAACCAGTATTCCCACAT pLKO.1 1486 CDS 100% 4.050 2.835 N OLFM2 n/a
9 TRCN0000188842 GCTCTACAATGTCACCCTGTT pLKO.1 1570 CDS 100% 4.050 2.835 N OLFM2 n/a
10 TRCN0000373122 CTGGTACATGGATGGCTATTA pLKO_005 946 CDS 100% 13.200 7.920 N OLFM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04596 pDONR223 100% 93.7% 90.8% None (many diffs) n/a
2 ccsbBroad304_04596 pLX_304 0% 93.7% 90.8% V5 (many diffs) n/a
Download CSV