Transcript: Human NM_001304449.1

Homo sapiens zinc finger protein 806 (ZNF806), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF806 (646915)
Length:
1867
CDS:
87..1856

Additional Resources:

NCBI RefSeq record:
NM_001304449.1
NBCI Gene record:
ZNF806 (646915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240171 GCCCTACAAATGCCACGTATG pLKO_005 1109 CDS 100% 6.000 8.400 N ZNF806 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08039 pDONR223 100% 94.3% 79.1% None (many diffs) n/a
2 ccsbBroad304_08039 pLX_304 0% 94.3% 79.1% V5 (many diffs) n/a
3 TRCN0000469631 TTGTACGGTATTTGGCTGAATTAT pLX_317 25.3% 94.3% 79.1% V5 (many diffs) n/a
4 ccsbBroadEn_14112 pDONR223 100% 69.6% 55.5% None (many diffs) n/a
5 ccsbBroad304_14112 pLX_304 0% 69.6% 55.5% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000476357 CGGACGGCTCCCGCTGATGTTAGA pLX_317 27% 69.6% 55.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV