Transcript: Human NM_001305108.1

Homo sapiens PTOV1 extended AT-hook containing adaptor protein (PTOV1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-01-23
Taxon:
Homo sapiens (human)
Gene:
PTOV1 (53635)
Length:
1485
CDS:
147..1271

Additional Resources:

NCBI RefSeq record:
NM_001305108.1
NBCI Gene record:
PTOV1 (53635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001305108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140104 GTTCCACTTCACCAACAGAGA pLKO.1 542 CDS 100% 2.640 2.112 N PTOV1 n/a
2 TRCN0000281091 GTTCCACTTCACCAACAGAGA pLKO_005 542 CDS 100% 2.640 2.112 N PTOV1 n/a
3 TRCN0000122043 CAGATCGTCAACAACAAGTTT pLKO.1 801 CDS 100% 5.625 3.938 N PTOV1 n/a
4 TRCN0000140055 CTACTCTGACTCCACTGCAAA pLKO.1 371 CDS 100% 4.950 3.465 N PTOV1 n/a
5 TRCN0000281022 CTACTCTGACTCCACTGCAAA pLKO_005 371 CDS 100% 4.950 3.465 N PTOV1 n/a
6 TRCN0000140135 GAAGCTGTACATGCAGCTCAT pLKO.1 950 CDS 100% 0.405 0.284 N PTOV1 n/a
7 TRCN0000139117 CAGTTCCACTTCACCAACAGA pLKO.1 540 CDS 100% 3.000 1.800 N PTOV1 n/a
8 TRCN0000143781 GTCAACAACAAGTTTCTGGCA pLKO.1 807 CDS 100% 0.660 0.396 N PTOV1 n/a
9 TRCN0000281090 GTCAACAACAAGTTTCTGGCA pLKO_005 807 CDS 100% 0.660 0.396 N PTOV1 n/a
10 TRCN0000140599 GAAGCTGATCATGCAGCTGAT pLKO.1 464 CDS 100% 0.405 0.243 N PTOV1 n/a
11 TRCN0000139737 CCTGTACTCGTCCAAGAAGAA pLKO.1 665 CDS 100% 4.950 2.475 Y PTOV1 n/a
12 TRCN0000121936 CTCGTCCAAGAAGAAGATCTT pLKO.1 671 CDS 100% 4.950 2.475 Y PTOV1 n/a
13 TRCN0000143741 GTACTCGTCCAAGAAGAAGAT pLKO.1 668 CDS 100% 4.950 2.475 Y PTOV1 n/a
14 TRCN0000281089 GTACTCGTCCAAGAAGAAGAT pLKO_005 668 CDS 100% 4.950 2.475 Y PTOV1 n/a
15 TRCN0000144585 GTCCAAGAAGAAGATCTTCAT pLKO.1 674 CDS 100% 4.950 2.475 Y PTOV1 n/a
16 TRCN0000140076 GAAGATCTTCATGGGCCTCAT pLKO.1 683 CDS 100% 4.050 2.025 Y PTOV1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.