Transcript: Mouse NM_001305804.1

Mus musculus pantothenate kinase 4 (Pank4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pank4 (269614)
Length:
2749
CDS:
24..2486

Additional Resources:

NCBI RefSeq record:
NM_001305804.1
NBCI Gene record:
Pank4 (269614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001305804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362283 TGACCAAGTTGGCATACTATT pLKO_005 157 CDS 100% 13.200 18.480 N Pank4 n/a
2 TRCN0000221748 CCATTGATATAGGTGGATCAT pLKO.1 136 CDS 100% 4.950 6.930 N Pank4 n/a
3 TRCN0000221747 CCCTCATAAATGTGCCTTAAT pLKO.1 1862 CDS 100% 13.200 9.240 N Pank4 n/a
4 TRCN0000362285 CTGTGTTCACACCGGAGTATT pLKO_005 2551 3UTR 100% 13.200 9.240 N Pank4 n/a
5 TRCN0000362284 CCTACCTCCTAGTCAACATTG pLKO_005 586 CDS 100% 10.800 7.560 N Pank4 n/a
6 TRCN0000221749 CCCTACCTCCTAGTCAACATT pLKO.1 585 CDS 100% 5.625 3.938 N Pank4 n/a
7 TRCN0000221751 CGCCTGCATTTCATCAAGTTT pLKO.1 291 CDS 100% 5.625 3.938 N Pank4 n/a
8 TRCN0000221750 CGCACAATCACCTACAGCATT pLKO.1 1023 CDS 100% 4.950 3.465 N Pank4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03555 pDONR223 100% 80.6% 86.9% None (many diffs) n/a
2 ccsbBroad304_03555 pLX_304 0% 80.6% 86.9% V5 (many diffs) n/a
3 TRCN0000480786 CGGTTTGGCCTGTAAAGGACGACC pLX_317 18.1% 80.6% 86.9% V5 (many diffs) n/a
Download CSV