Transcript: Mouse NM_001305980.2

Mus musculus diaphanous related formin 1 (Diaph1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Diaph1 (13367)
Length:
5693
CDS:
159..3953

Additional Resources:

NCBI RefSeq record:
NM_001305980.2
NBCI Gene record:
Diaph1 (13367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001305980.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108686 GCGCAGAATCTCTCAATCTTT pLKO.1 2703 CDS 100% 5.625 7.875 N Diaph1 n/a
2 TRCN0000303127 GCGCAGAATCTCTCAATCTTT pLKO_005 2703 CDS 100% 5.625 7.875 N Diaph1 n/a
3 TRCN0000108685 GCCTAAATGGTCAAGGAGATA pLKO.1 4015 3UTR 100% 4.950 6.930 N Diaph1 n/a
4 TRCN0000303129 GCCTAAATGGTCAAGGAGATA pLKO_005 4015 3UTR 100% 4.950 6.930 N Diaph1 n/a
5 TRCN0000108688 CGGCACGAGTTACAAGTAGAA pLKO.1 1641 CDS 100% 4.950 3.960 N Diaph1 n/a
6 TRCN0000303056 CGGCACGAGTTACAAGTAGAA pLKO_005 1641 CDS 100% 4.950 3.960 N Diaph1 n/a
7 TRCN0000108687 CCGCTGTTTGAAGGCTTTCAT pLKO.1 812 CDS 100% 5.625 3.938 N Diaph1 n/a
8 TRCN0000303125 CCGCTGTTTGAAGGCTTTCAT pLKO_005 812 CDS 100% 5.625 3.938 N Diaph1 n/a
9 TRCN0000108689 GCTGCGTAAGAGTGAGAACTT pLKO.1 3032 CDS 100% 4.950 3.465 N Diaph1 n/a
10 TRCN0000303059 GCTGCGTAAGAGTGAGAACTT pLKO_005 3032 CDS 100% 4.950 3.465 N Diaph1 n/a
11 TRCN0000118681 GCATGCCCTATCAAGAGATTA pLKO.1 2737 CDS 100% 13.200 9.240 N DIAPH1 n/a
12 TRCN0000299579 GCATGCCCTATCAAGAGATTA pLKO_005 2737 CDS 100% 13.200 9.240 N DIAPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305980.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465905 TAATCAAATAAGTATCCCCGATCA pLX_317 9.8% 85.5% 81.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV