Transcript: Mouse NM_001306069.1

Mus musculus adiponectin receptor 1 (Adipor1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Adipor1 (72674)
Length:
3255
CDS:
421..1548

Additional Resources:

NCBI RefSeq record:
NM_001306069.1
NBCI Gene record:
Adipor1 (72674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001306069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249147 GTACGTCCAGGCTTCAAATAA pLKO_005 2044 3UTR 100% 15.000 21.000 N Adipor1 n/a
2 TRCN0000249150 TTCGTTCCCTGGCTCTATTAC pLKO_005 1078 CDS 100% 13.200 18.480 N Adipor1 n/a
3 TRCN0000184546 GACAACGACTACCTGCTACAT pLKO.1 736 CDS 100% 4.950 6.930 N Adipor1 n/a
4 TRCN0000249148 GACGATGCTGAGACCAAATAT pLKO_005 882 CDS 100% 15.000 10.500 N Adipor1 n/a
5 TRCN0000257836 AGATGGAGGAGTTCGTGTATA pLKO_005 656 CDS 100% 13.200 9.240 N Adipor1 n/a
6 TRCN0000249149 GGGATTGCTCTACTGATTATG pLKO_005 1051 CDS 100% 13.200 9.240 N Adipor1 n/a
7 TRCN0000184300 GCTGAAAGACAACGACTACCT pLKO.1 729 CDS 100% 2.640 1.848 N Adipor1 n/a
8 TRCN0000183806 CTGGGATTCTTCAGAAATTAT pLKO.1 1848 3UTR 100% 15.000 9.000 N Adipor1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03202 pDONR223 100% 90.9% 96.8% None (many diffs) n/a
2 ccsbBroad304_03202 pLX_304 0% 90.9% 96.8% V5 (many diffs) n/a
3 TRCN0000471475 GAGGTCGCACTGGCTGGATGGCCA pLX_317 46.9% 90.9% 96.8% V5 (many diffs) n/a
Download CSV