Transcript: Human NM_001307930.2

Homo sapiens RAS like family 12 (RASL12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RASL12 (51285)
Length:
2462
CDS:
157..900

Additional Resources:

NCBI RefSeq record:
NM_001307930.2
NBCI Gene record:
RASL12 (51285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001307930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072988 CCCACAGTTTATCCAAGGAAA pLKO.1 1436 3UTR 100% 4.950 3.960 N RASL12 n/a
2 TRCN0000424346 GAAGAAATTGCAGTGTCTATC pLKO_005 1183 3UTR 100% 10.800 7.560 N RASL12 n/a
3 TRCN0000414823 GTGTCCCTACACTCAATTCAC pLKO_005 1023 3UTR 100% 4.950 3.465 N RASL12 n/a
4 TRCN0000418197 TGAGCACGTGCAGCATGTCTT pLKO_005 606 CDS 100% 4.950 3.465 N RASL12 n/a
5 TRCN0000072991 CCCTCTTCATCTCCGAGGAGA pLKO.1 683 CDS 100% 0.880 0.616 N RASL12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001307930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08272 pDONR223 100% 92.7% 92.8% None 102_103ins57;576C>T n/a
2 ccsbBroad304_08272 pLX_304 0% 92.7% 92.8% V5 102_103ins57;576C>T n/a
3 TRCN0000470447 AATGCACCAAATTCCTAAGTCAGC pLX_317 55.9% 92.7% 92.8% V5 102_103ins57;576C>T n/a
Download CSV