Transcript: Human NM_001307941.2

Homo sapiens SEC11 homolog C, signal peptidase complex subunit (SEC11C), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SEC11C (90701)
Length:
733
CDS:
66..551

Additional Resources:

NCBI RefSeq record:
NM_001307941.2
NBCI Gene record:
SEC11C (90701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001307941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046759 GCCAGCTCTATTACCAGGTTT pLKO.1 148 CDS 100% 4.950 6.930 N SEC11C n/a
2 TRCN0000046761 CCCAATCAGAGCTGGTGAAAT pLKO.1 326 CDS 100% 13.200 9.240 N SEC11C n/a
3 TRCN0000444980 GACATCAAATTTCTGACTAAA pLKO_005 423 CDS 100% 13.200 9.240 N SEC11C n/a
4 TRCN0000046760 CACAGAGTAATCAAAGTTCAT pLKO.1 387 CDS 100% 4.950 3.465 N SEC11C n/a
5 TRCN0000046758 GAGAAGCAGTTCCTGGGACCA pLKO.1 590 3UTR 100% 0.720 0.504 N SEC11C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001307941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04527 pDONR223 100% 83.8% 81.7% None 466_467ins58;483_484ins35 n/a
2 ccsbBroad304_04527 pLX_304 0% 83.8% 81.7% V5 466_467ins58;483_484ins35 n/a
3 TRCN0000473398 TTAAAAGTCTATCAGTCGCAGGCA pLX_317 32% 83.8% 81.7% V5 466_467ins58;483_484ins35 n/a
Download CSV